Nachweis bakterieller Translokation am Beispiel Enterococcus sp. durch real-time PCR aus Blut kritisch kranker Patienten

Neugebauer, Sophie

dc.contributor.advisor	Schäper, Jörn PD Dr.
dc.contributor.author	Neugebauer, Sophie
dc.date.accessioned	2023-02-23T14:53:10Z
dc.date.available	2023-03-09T00:50:12Z
dc.date.issued	2023-02-23
dc.identifier.uri	http://resolver.sub.uni-goettingen.de/purl?ediss-11858/14530
dc.identifier.uri	http://dx.doi.org/10.53846/goediss-9751
dc.format.extent	86 Seiten	de
dc.language.iso	deu	de
dc.subject.ddc	610	de
dc.title	Nachweis bakterieller Translokation am Beispiel Enterococcus sp. durch real-time PCR aus Blut kritisch kranker Patienten	de
dc.type	doctoralThesis	de
dc.title.translated	Detection of bacterial translocation using the example of Enterococcus sp. through real-time PCR from blood of critically ill patients	de
dc.contributor.referee	Lüder, Carsten Prof. Dr.
dc.date.examination	2023-03-01	de
dc.description.abstractger	Die Entwicklung einer generalisierten dysregulierten Entzündungsreaktion in Form von Systemic Inflammatory Response Syndrome (SIRS) und Sepsis spielt bei den in dieser Arbeit untersuchten Patientenkollektiven (polytraumatisierte Patienten mit und ohne Schädel-Hirn-Trauma (SHT), Patienten mit isoliertem SHT, Patienten mit aneurysmatischer Subarachnoidalblutung oder spontanen intracerebralen intraparenchymatösen Blutungen) eine wichtige Rolle. Veränderungen im kardiovaskulären System, immunologische bzw. inflammatorische Prozesse, verringerte Durchblutung des Darms, Darmmotilitätsstörungen, Veränderungen im Mikrobiom, eine erhöhte gastrointestinale Permeabilität und die Translokation von Bakterien oder pathogen-associated molecular patterns (PAMPs) haben Auswirkungen auf den Krankheitsverlauf. Es gibt aktuell zwei Theorien wie bakterielle Translokation stattfinden kann. Erstens, die bisher nicht bewiesene Theorie der systemischen bakteriellen Translokation mit einem Übertritt von Bakterien oder deren pathogenen Bestandteilen in das portal-venöse System. Zweitens, die Gut-Lymph-Hypothese, die experimentell bewiesen werden konnte. Bakterien oder deren pathogene Bestandteile aktivieren das intestinale Immunsystem. Eine daraufhin folgende intestinale proinflammatorische Antwort treibt die Mukosaschädigung voran und danger-associated molecular patterns (DAMPs) können in die mesenterialen Lymphknoten gelangen und weiter über den Ductus thoracicus zur Lunge und über die V. subclavia in den systemischen Kreislauf transportiert werden. Der Gastrointestinaltrakt (GIT) fungiert als proinflammatorisches Organ. Ziel der Arbeit war es, das Auftreten einer bakteriellen Translokation in Zusammenhang mit den Markern der epithelialen Permeabilitätserhöhung (intestinal fatty acid binding protein (iFABP) und Claudin 3), dem Marker der gesteigerten Monozytenaktivität (soluble CD14 (sCD14)), dem Ausmaß der systemischen Inflammation (Procalcitonin (PCT), Leukozyten, C-reaktives Protein (CRP)) und der Schwere des Krankheitsverlaufs (Sequential Organ Failure Assessment Score (SOFA-Score), SIRS, Sepsis, schwere Sepsis, septischer Schock, Versterben auf der Intensivstation und 28-Tage- und 90-Tage-Letalität) zu bringen. Diese experimentelle Doktorarbeit wendet die Methode der real-time PCR mit dem LightCycler® 480 zum Nachweis von Enterococcus-DNA in Blutproben der in dieser Arbeit eingeschlossenen Patienten an. Die verwendeten Primer F: 5‘CCCTTATTGTTAGTTGCCATCATT3‘ und R: 5‘ACTCGTTGTACTTCCCATTGT3‘, entnommen aus Rinttilä et al. 2004, amplifizieren einen definierten Bereich innerhalb des 16S rRNA-Gens von E. faecalis. Es konnte das Vorliegen von Enterococcus-DNA im Blut von 46 von insgesamt 90 kritisch kranken Patienten nachgewiesen werden. Dies entspricht 70 aus insgesamt 551 Blutproben. Die Methode befand sich an der unteren Nachweisgrenze, was an den späten crossing points deutlich wurde. Mittels Sequenzierung einiger ausgewählter Proben war nur eine Aussage auf Gattungsebene (Enterococcus) möglich. Es zeigte sich kein statistisch signifikanter Zusammenhang zwischen der epithelialen Permeabilitätserhöhung, der gesteigerten Monozytenaktivität, dem Ausmaß der systemischen Inflammation, der Schwere des Krankheitsverlaufs und dem Auftreten einer bakteriellen Translokation der Spezies Enterococcus sp. Die Hypothese, dass eine bakterielle Translokation als ein Faktor innerhalb eines multifaktoriellen Geschehens stattfindet, ist sehr wahrscheinlich und wird von den Ergebnissen dieser Untersuchung getragen. Allerdings kann ein direkt kausaler Zusammenhang der bakteriellen Translokation auf die Entwicklung und Aufrechterhaltung eines SIRS, einer Sepsis, einer schweren Sepsis oder eines septischen Schocks durch die Ergebnisse dieser Arbeit nicht dargestellt werden.	de
dc.description.abstracteng	The development of a generalized dysregulated inflammatory reaction in the form of Systemic Inflammatory Response Syndrome (SIRS) and sepsis are relevant in the patient collectives examined in this work (polytraumatized patients with and without traumatic brain injury (TBI), patients with isolated TBI, patients with aneurysmal subarachnoid hemorrhage or spontaneous intracerebral intraparenchymal hemorrhage). Changes in the cardiovascular system, immunological or inflammatory processes, reduced blood flow in the intestine, intestinal motility disorders, altered microbiome, increased gastrointestinal permeability and translocation of bacteria or pathogen-associated molecular patterns (PAMPS) have an impact on the course of the disease. There are currently two theories of how bacterial translocation can occur. First, the so far unproven theory of systemic bacterial translocation with the passage of bacteria or their pathogenic components into the portal venous system. Second, the gut-lymph hypothesis, which has already been proven experimentally. Bacteria or their pathogenic components activate the intestinal immune system. An intestinal proinflammatory response further damages the mucosa and danger-associated molecular patterns (DAMPs) can reach the mesenteric lymph nodes and are transported further via the thoracic duct to the lungs and via the subclavian vein into the systemic circulation. The gastrointestinal tract acts as a proinflammatory organ. The aim of this doctoral thesis was to compare the occurrence of a bacterial translocation with the markers of the increase of the intestinal epithelial permeability (intestinal fatty acid binding protein (iFABP) and Claudin 3), the marker of the increased monocyte activity (soluble CD14 (sCD14)), the extent of the systemic inflammation (procalcitonin (PCT), leukocytes, C-reactive protein (CRP)) and the severity of the course of the disease (Sequential Organ Failure Assessment score (SOFA score), SIRS, sepsis, severe sepsis, septic shock, death in the intensive care unit and 28-day and 90-day lethality). This experimental doctoral thesis uses the method of real-time PCR using the LightCycler® 480 to detect Enterococcus DNA in blood samples from the patients included in this work. The primers F: 5'CCCTTATTGTTAGTTGCCATCATT3' and R: 5'ACTCGTTGTACTTCCCATTGT3', taken from Rinttilä et al. 2004, amplify a defined region within the E. faecalis 16S rRNA gene. The presence of Enterococcus DNA in the blood of 46 out of a total of 90 critically ill patients could be detected. This corresponds to 70 out of a total of 551 blood samples. The method was at the lower detection limit, which was shown by the late crossing points. By sequencing some selected samples, only a statement at genus level (Enterococcus) was possible. There was no statistically significant connection between the increase of the intestinal epithelial permeability, the increased monocyte activity, the extent of the systemic inflammation, the severity of the course of the disease and the occurrence of a bacterial translocation of the species Enterococcus sp. The hypothesis that bacterial translocation occurs as a factor within a multifactorial process is very likely and is supported by the results of this study. However, a direct causal relationship between bacterial translocation and the development and maintenance of SIRS, sepsis, severe sepsis or septic shock cannot be shown by the results of this work.	de
dc.contributor.coReferee	Schön, Margarete Prof. Dr.
dc.subject.ger	bakterielle Translokation	de
dc.subject.ger	Polymerasekettenreaktion	de
dc.subject.ger	Enterococcus	de
dc.subject.ger	intestinale Barrierefunktionsstörung	de
dc.subject.ger	intestinale epitheliale Permeabilität	de
dc.subject.ger	SIRS	de
dc.subject.ger	Sepsis	de
dc.subject.ger	Polytrauma	de
dc.subject.ger	Schädel-Hirn-Trauma	de
dc.subject.ger	kritisch kranke Patienten	de
dc.subject.ger	Inflammation	de
dc.subject.eng	bacterial translocation	de
dc.subject.eng	polymerase chain reaction	de
dc.subject.eng	Enterococcus	de
dc.subject.eng	intestinal barrier dysfunction	de
dc.subject.eng	intestinal epithelial permeability	de
dc.subject.eng	SIRS	de
dc.subject.eng	sepsis	de
dc.subject.eng	polytrauma	de
dc.subject.eng	traumatic brain injury	de
dc.subject.eng	critically ill patients	de
dc.subject.eng	inflammation	de
dc.identifier.urn	urn:nbn:de:gbv:7-ediss-14530-0
dc.affiliation.institute	Medizinische Fakultät	de
dc.subject.gokfull	Anästhesiologie / Intensivmedizin / Notfallmedizin / Analgesie - Allgemein- und Gesamtdarstellungen (PPN619875917)	de
dc.description.embargoed	2023-03-09	de
dc.identifier.ppn	1837640092
dc.notes.confirmationsent	Confirmation sent 2023-02-23T15:15:01	de

Dateien

Name:Dissertation_Sophie_Neugebauer.pdf

Größe:1.238Mb

Format:PDF

Öffnen

Name:: Dissertation_Sophie_Neugebauer.pdf
Größe:: 1.238Mb
Format:: PDF

Öffnen

Das Dokument erscheint in:

Human- und Zahnmedizin [2872]

Zur Kurzanzeige